snOPY snoRNA Orthological Gene Database
Echinops_telfairi SNORD48
sequence
CGAGGATGATGACCCCAGGTGATTCTGAGTGACTTTGCTGACGCATCACCGCAGCGCGC
TGACG
  Box motif
  Complementary to target RNA
length 64
organism Echinops_telfairi
snoRNA name SNORD48
alias
chromosome ⁄ contig scaffold_260944
locus ⁄ host gene
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved