snOPY snoRNA Orthological Gene Database
Echinops_telfairi SNORA33
sequence
AAGCCAGCCATTGATTCTGCTTACTTGATTGTGTTTCTGCAGAAATTTAGAAAAAGCTG
GCAATAACAGTAAAGCCATGTTACGAGCCTTAAGGATAATTGAGATCATTAAGGTCCCTG
AAAATGGCTACATTA
  Box motif
  Complementary to target RNA
length 134
organism Echinops_telfairi
snoRNA name SNORA33
alias
chromosome ⁄ contig scaffold_318212
locus ⁄ host gene ENSETEG00000006854
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved