snOPY snoRNA Orthological Gene Database
Echinops_telfairi SNORA14
sequence
AGGCCTTGGAACAATACGCTAATTTATCTTAAGAAATTCCCAAGATCTGGGTGAATGCT
ACAGAGATTGCAGGCAATCCAAAAGGCTGTGCAACCCAGTGGCCCGGCCTTATTTCACAC
CTGCAACATCT
  Box motif
  Complementary to target RNA
length 130
organism Echinops_telfairi
snoRNA name SNORA14
alias
chromosome ⁄ contig GeneScaffold_395
locus ⁄ host gene Mono:632:SNORA14
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved