snOPY snoRNA Orthological Gene Database
Echinops_telfairi SNORD81
sequence
TTAAATACATGATGATCTACCCCAACTTGAACTCTCTCACTGATAACTTGATGATAATG
GGAAGGAAAAAAAAAAGAGTACTTAA
  Box motif
  Complementary to target RNA
length 85
organism Echinops_telfairi
snoRNA name SNORD81
alias
chromosome ⁄ contig scaffold_32024
locus ⁄ host gene Mono:208:SNORD81
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved