snOPY snoRNA Orthological Gene Database
Echinops_telfairi SNORA5
sequence
TGCAGCCGTGTCAGATGCAGTGCGTGCCCCACCCATGGCTGGCACTGGCCCAAAAGGCT
GCCACAGAGACACTGTAACTCATGGGCCCTGTTCCTCTCTGCTGAGCCTCAGGGATAAAC
GTTGTTACAGACATTG
  Box motif
  Complementary to target RNA
length 135
organism Echinops_telfairi
snoRNA name SNORA5
alias
chromosome ⁄ contig scaffold_292472
locus ⁄ host gene Mono:125:SNORA5
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved