snOPY snoRNA Orthological Gene Database
Echinops_telfairi SNORA44
sequence
GCGCATGTTCCCAAGGTCTGTGGCTCATGTGGCCATCTGATCTCCAACTGCATGCGAGA
GCAACGTGGAGAGACTTTGACAGCTCAGGCCAGCAAAGTATCTGCAGCTGCCACTCGCCT
TTCCTATAAAA
  Box motif
  Complementary to target RNA
length 130
organism Echinops_telfairi
snoRNA name SNORA44
alias
chromosome ⁄ contig GeneScaffold_7448
locus ⁄ host gene Poly:8:SNORD99
organization Poly
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved