snOPY snoRNA Orthological Gene Database
Echinops_telfairi SNORD93
sequence
TGGCCAAGGATGAGAACTCTTAATCTGATTGGGCATGCTTTTGCTCTGATGGGTTAAAG
GATTTACTCTGAGGCCA
  Box motif
  Complementary to target RNA
length 76
organism Echinops_telfairi
snoRNA name SNORD93
alias
chromosome ⁄ contig GeneScaffold_2950
locus ⁄ host gene Mono:550:SNORD93
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved