snOPY snoRNA Orthological Gene Database
Echinops_telfairi SNORD102
sequence
AGCTTGATGATGATTGTTTGATTGCTTTGAAGCAACATGAAAAATCCATTTCACCGGCT
CTGAGAGCT
  Box motif
  Complementary to target RNA
length 68
organism Echinops_telfairi
snoRNA name SNORD102
alias
chromosome ⁄ contig GeneScaffold_5141
locus ⁄ host gene Poly:5:SNORD102
organization Poly
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved