snOPY snoRNA Orthological Gene Database
Echinops_telfairi SNORD65
sequence
ATGTGATGAAATAACCTGAAATAGCTGGAATTACCGGCAGATGGTATGGTGGTGAGTCT
GGTTTTCTGAAG
  Box motif
  Complementary to target RNA
length 71
organism Echinops_telfairi
snoRNA name SNORD65
alias
chromosome ⁄ contig GeneScaffold_8019
locus ⁄ host gene Mono:532:SNORD65
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved