snOPY snoRNA Orthological Gene Database
Echinops_telfairi SNORD75
sequence
AGCCTGTGATGGTATTCAGAGTAGTGGACTGAAGGGATTTCTGAAAGAAAAAAAAGTAA
TGCTGAGGCT
  Box motif
  Complementary to target RNA
length 69
organism Echinops_telfairi
snoRNA name SNORD75
alias
chromosome ⁄ contig GeneScaffold_2637
locus ⁄ host gene Poly:9:SNORD81
organization Poly
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved