snOPY snoRNA Orthological Gene Database
Echinops_telfairi SNORA49
sequence
TCCTCTCAGCCTTACTCCAGGGCCTTCTCGCTGTAGAGTGACCGGGCATTGCCTGAGGA
TAGATAAGAAAGGCCGTGTCCCTCCCCAGGAAGAACCCACTTTCTTCTGGGGCCTACACA
CTGAGCTAACAGT
  Box motif
  Complementary to target RNA
length 132
organism Echinops_telfairi
snoRNA name SNORA49
alias
chromosome ⁄ contig GeneScaffold_301
locus ⁄ host gene Mono:546:SNORA49
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved