snOPY snoRNA Orthological Gene Database
Echinops_telfairi SNORA33
sequence
AGGCTTGAAGAGTTCAGGGGAATTGATTGTGTTTCTGCAGAAATTTAGAAAAAGCTGGC
AGTAACAGTAAAGCCATGTTACGAGCCTTAAGGATAATTGAGATCATTAAGGTCCCTGAA
AATGGCTACATTT
  Box motif
  Complementary to target RNA
length 132
organism Echinops_telfairi
snoRNA name SNORA33
alias
chromosome ⁄ contig scaffold_302598
locus ⁄ host gene Poly:0:SNORA33
organization Poly
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved