snOPY snoRNA Orthological Gene Database
Echinops_telfairi SNORD87
sequence
ACTGGCACTATGATGATTTCCAGTTACTTTTTGCCGTTTACCCATCTGAGAGTTTCTTT
GAAGAACATCTTGAAACTGAGTTGCCAGT
  Box motif
  Complementary to target RNA
length 88
organism Echinops_telfairi
snoRNA name SNORD87
alias
chromosome ⁄ contig GeneScaffold_1634
locus ⁄ host gene Mono:529:SNORD87
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved