snOPY snoRNA Orthological Gene Database
Echinops_telfairi SNORA31
sequence
ACATCCTCTGATAGACCTGGGACAATTGACCATTGTTCTTCTGGTTTGCACTAGGATGA
GAAAGAATACAAAATCCCTGTGCTTTCTGCCTGTCTTTGTGGAGGCTTCAAATTGAATGA
GGGATTACATAG
  Box motif
  Complementary to target RNA
length 131
organism Echinops_telfairi
snoRNA name SNORA31
alias
chromosome ⁄ contig scaffold_256903
locus ⁄ host gene Mono:86:SNORA31
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved