snOPY snoRNA Orthological Gene Database
Echinops_telfairi SNORD56
sequence
GCACAGTGATGGTACTATTTTTTGCCAACAGCAGTTCACCTAGTGAATGTTGATAGTGT
TGGGTCTGAGTGA
  Box motif
  Complementary to target RNA
length 72
organism Echinops_telfairi
snoRNA name SNORD56
alias
chromosome ⁄ contig scaffold_276126
locus ⁄ host gene Mono:185:SNORD56
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved