snOPY snoRNA Orthological Gene Database
Echinops_telfairi SNORD73
sequence
AATGAAGGATGACAAAATGTTTCGGTCCCAAATGATCGTACTGATTATACCGTTATGTT
TGGTTCTGACATT
  Box motif
  Complementary to target RNA
length 72
organism Echinops_telfairi
snoRNA name SNORD73
alias
chromosome ⁄ contig scaffold_309080
locus ⁄ host gene Mono:263:SNORD73
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved