snOPY snoRNA Orthological Gene Database
Echinops_telfairi SNORA79
sequence
TGATGACTGTTCCTCCTATTGCCTTCAGACCTGGCACTAGGGTTTTAGGGCATCATAAA
TAAAAAATTGATTTTCTTCACTCATAGGATAATGGGTTTTATCTGACTAGTCTCTGAAAT
TTGCGGAATCAAACAGCT
  Box motif
  Complementary to target RNA
length 137
organism Echinops_telfairi
snoRNA name SNORA79
alias
chromosome ⁄ contig scaffold_165156
locus ⁄ host gene Mono:59:SNORA79
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved