snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster snoRNA:Psi18S-1377e
sequence
CCGTTCTTGTGTTATTTTCTGGACGTTGTTCAAGTCCAGCGATCGTCAAACAGAACGCA
AAGTAATGCAACGAATCACTCCACAATGTTGGGTCTACTTTGCCAGGACAGCATCATTAC
TTAAGGATTGCAACAGCA
  Box motif
  Complementary to target RNA
length 137
organism Drosophila_melanogaster
snoRNA name snoRNA:Psi18S-1377e
alias
chromosome ⁄ contig 3R
locus ⁄ host gene RpS7
organization Intronic
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U1377
accession no NR_003915,AE014297
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved