snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster snoRNA:Psi28S-2149
sequence
TGCCGCCTATTTGCCTCTCGAGCGCCGTTTAGTTTCCTGGGGCCTCGGGACTTCCTATA
TAAGCGGAAGATTAATCCAGCCTACCGTACGATATCTTCGCTGCGGTATTTTCTGCCGCA
GCGGAGGTTGCGGTGCTGTACACTG
  Box motif
  Complementary to target RNA
length 144
organism Drosophila_melanogaster
snoRNA name snoRNA:Psi28S-2149
alias
chromosome ⁄ contig 3R
locus ⁄ host gene RpS7
organization Intronic
target RNA 28S rRNA
modification type H/ACA
modification site 28S:U2149
accession no NR_002505,AE014297
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved