snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster snoRNA:Me28S-A2564
sequence
TGTTATAGTGATGTAAAAACCCTAGCGATCCAGCTACTTTATTGTGTTGATCTTGTTTT
AAGAGAGACGCAAGCCTGTTGGGTGTGATTCTGCTTGTCATAGTTACTCTGATCAGAC
  Box motif
  Complementary to target RNA
length 117
organism Drosophila_melanogaster
snoRNA name snoRNA:Me28S-A2564
alias
chromosome ⁄ contig 3R
locus ⁄ host gene RpS8
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site 28S:A2564
accession no NR_002504,AE014297
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved