snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster snoRNA:Or-CD8
sequence
TGTTAAATGATGTTAACGCGTGTCAACTGCAATTGTGCTCTCGAGTACTCTTCTTGATG
ATTGAAAAGCTTTATGTTCGGACTACTGATAAA
  Box motif
  Complementary to target RNA
length 92
organism Drosophila_melanogaster
snoRNA name snoRNA:Or-CD8
alias
chromosome ⁄ contig 3R
locus ⁄ host gene RpS8
organization Intronic
target RNA
modification type unknown
modification site
accession no NR_003914,AE014297
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved