snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster snoRNA:291
sequence
GGCGTTGTTCCATCCGCACATGATTCTTCTCCCTGGAGGAGCGAGTGATTACCTGCAAG
GGCCAACTGAAGGCA
  Box motif
  Complementary to target RNA
length 74
organism Drosophila_melanogaster
snoRNA name snoRNA:291
alias
chromosome ⁄ contig 3R
locus ⁄ host gene CG1646
organization Intronic
target RNA
modification type unknown
modification site
accession no NR_002503,AE014297
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved