snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster snoRNA:Me18S-G1189
sequence
TCCCTAATGATGCTGGACTGAGCCGGAGCCCGAGCTTAAACTGTTGCTCTTGAGATCTT
GAAATCTGAGGGG
  Box motif
  Complementary to target RNA
length 72
organism Drosophila_melanogaster
snoRNA name snoRNA:Me18S-G1189
alias
chromosome ⁄ contig 3R
locus ⁄ host gene NK7.1
organization Intronic
target RNA 18S rRNA
modification type C/D
modification site 18S:G1189
accession no NR_003895,AE014297
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved