snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster snoRNA:Me18S-G1358a
sequence
TTTCAAATGATGATATTTCCATGCACCACTCTGAAGCTTTTATTAGCATCGTGCAGATT
ATGGATTTCTGAAAAT
  Box motif
  Complementary to target RNA
length 75
organism Drosophila_melanogaster
snoRNA name snoRNA:Me18S-G1358a
alias
chromosome ⁄ contig 3R
locus ⁄ host gene CG33936
organization Intronic
target RNA 18S rRNA
modification type C/D
modification site 18S:G1358
accession no NR_003890,AE014297
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved