snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster snoRNA:MeU5-C46
sequence
TGCCCATGATGAAATATTCGACATCGGAGTTTGCGCATTGGCGACAAGACCTAAGGCTC
AGACTCTAGCAAATCTAGTTTCATCCGTTGTAATCTTTGCTGCTGCACTCCAGAATTTGC
AGTGGCCGTAAGGCCAGCGGGACACCAACAGCCAGGGATCAAGACTATTATCTGTCATTG
AGTCCTAGACAGATAGTTTAGTCTCTGGTTTACAGAACACCCAAATGGAAATGAAACACG
CGCTTTTGTCGACCCAGGAGCCAGTTAGGTCTAAGCTGTTTGTCATGGTGACGACGTCTT
TAGTAATCTGAGCGCAA
  Box motif
  Complementary to target RNA
length 316
organism Drosophila_melanogaster
snoRNA name snoRNA:MeU5-C46
alias
chromosome ⁄ contig 3R
locus ⁄ host gene CG1142
organization Intronic
target RNA U5 snRNA
modification type H/ACA,C/D
modification site U5:C46,U5:U47
accession no NR_001999,AE014297
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved