snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster snoRNA:Or-aca1
sequence
ACCTTCTCCCAGATTTTTGTTGGAACTTATAGCCGTTTCCAGGAAAAGACTCGAGCAGG
GAGATTAAGTGCATGTCGCAATCGAAGAGAACGTTGGCAGATTTGACCATTGTTATTTGA
GGCTTCATCGACACTT
  Box motif
  Complementary to target RNA
length 135
organism Drosophila_melanogaster
snoRNA name snoRNA:Or-aca1
alias
chromosome ⁄ contig 2R
locus ⁄ host gene RpS16
organization Intronic
target RNA
modification type unknown
modification site
accession no NR_003830,AE013599
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved