snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster snoRNA:Me28S-G2596
sequence
AAACAAATGATGAAGAAGACGATGACGAGGAAGAAGTTGGTGAAGAGGGAATGGTTGAT
ATTGATACTGAAGAT
  Box motif
  Complementary to target RNA
length 74
organism Drosophila_melanogaster
snoRNA name snoRNA:Me28S-G2596
alias
chromosome ⁄ contig 2R
locus ⁄ host gene dom
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site 28S:G2596
accession no NR_003824,AE013599
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved