snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster snoRNA:Psi18S-841b
sequence
TGCAAATGCACTCTGTGTCACATTGAATTTACCTACATGTGAAGACAATTTGTTAGTTT
GCTATATGAAAGAGATGTGACTTATCCATGCAATTAGTGCCGTAAAAGGTTGATTGCATT
GAAATCGCATTTTACACTA
  Box motif
  Complementary to target RNA
length 138
organism Drosophila_melanogaster
snoRNA name snoRNA:Psi18S-841b
alias
chromosome ⁄ contig 2R
locus ⁄ host gene dom
organization Intronic
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U841
accession no NR_003816,AE013599
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved