snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster snoRNA:Psi18S-1347b
sequence
AGCAACTTCTACCCATTGGTTGGTCAGATTTAACCCATTTTGACACGACTAAGATTCAT
AGTTGCCAGAGAAAGCAATGCGACTTACCATGCTGATGGGTTTTGCATACCATCTGCATA
ACAAACACTCAATGTATCACATGA
  Box motif
  Complementary to target RNA
length 143
organism Drosophila_melanogaster
snoRNA name snoRNA:Psi18S-1347b
alias
chromosome ⁄ contig 2R
locus ⁄ host gene pAbp
organization Intronic
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U1347
accession no NR_003807,AE013599
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved