snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster snoRNA:snR38:54Ec
sequence
ATGATGTGATGAACACCTTATTTAAGCCAAACAGTTATCCCTGTCATAAGAATAATTGA
TGATATATTCAGCTGACA
  Box motif
  Complementary to target RNA
length 77
organism Drosophila_melanogaster
snoRNA name snoRNA:snR38:54Ec
alias
chromosome ⁄ contig 2R
locus ⁄ host gene Uhg1
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site 28S:G3277
accession no NR_001769,AE013599
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved