snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster snoRNA:U27:54Eb
sequence
TTTTTCTGATGACAAACCAATAGACAAGCATATACCTGAATTCACGTGTGTTGCTAACA
TTTTTGACTGAAC
  Box motif
  Complementary to target RNA
length 72
organism Drosophila_melanogaster
snoRNA name snoRNA:U27:54Eb
alias
chromosome ⁄ contig 2R
locus ⁄ host gene Uhg1
organization Intronic
target RNA 18S rRNA
modification type C/D
modification site 18S:A28
accession no NR_001768,AE013599
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved