snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster snoRNA:U31:54Ed
sequence
ATATTATGATGATTAAGGATACCGCCCCAGTCGGAGAAATTATGTCGATTGGTTAAACA
TACTGACT
  Box motif
  Complementary to target RNA
length 67
organism Drosophila_melanogaster
snoRNA name snoRNA:U31:54Ed
alias
chromosome ⁄ contig 2R
locus ⁄ host gene Uhg1
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site 28S:G3081
accession no NR_001767,AE013599
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved