snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster snoRNA:U29:54Ed
sequence
AAAGTATGATGAAACATTTACCCAGCTCGCTTTGATATACAATGAAGAGAACTGTTCCA
TATCCAACGCAAAACTAAAATGCTGATT
  Box motif
  Complementary to target RNA
length 87
organism Drosophila_melanogaster
snoRNA name snoRNA:U29:54Ed
alias
chromosome ⁄ contig 2R
locus ⁄ host gene Uhg1
organization Intronic
target RNA 28S rRNA
modification type H/ACA
modification site 28S:A3407
accession no NR_001761,AE013599
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved