snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster snoRNA:Me28S-C3420a
sequence
CATACTCTGATGATAAAATCATGACGGTCTTCATAAAACAAATTGCTGAAAGAACTTGA
CTCTTTTTACTAAATGTAAAAATACTGAAACT
  Box motif
  Complementary to target RNA
length 91
organism Drosophila_melanogaster
snoRNA name snoRNA:Me28S-C3420a
alias
chromosome ⁄ contig 2R
locus ⁄ host gene RpS11
organization Intronic
target RNA
modification type C/D
modification site 28S:C3420
accession no NR_003118,AE013599
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved