snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster snoRNA:Psi28S-1180
sequence
CGGAGTATAACAGAAAATGTCTTGTCTATCGCGCAAGAACGTTTGAAGAAAATACTCCT
AGAGCATTTAGTAACTTGCTATTCGCTTTACACTGGCCACTACGCTTCACCCAGAGCAGG
GCAGTGAAAAATGGTCAAGCACAAAT
  Box motif
  Complementary to target RNA
length 145
organism Drosophila_melanogaster
snoRNA name snoRNA:Psi28S-1180
alias
chromosome ⁄ contig 2R
locus ⁄ host gene tou
organization Intronic
target RNA 28S rRNA
modification type H/ACA
modification site 28S:U1180
accession no NR_002542,AE013599
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved