snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster snoRNA:MeU6-C68
sequence
TTTAAGTTGATGATTCTCCATCCTTGCGCTCTGAGCTCTTTGCGGAGCTAAGAGGATAA
CCTGGTTCTTGCTTCTGCGCGGCAGATGCAAGCTGATTCC
  Box motif
  Complementary to target RNA
length 99
organism Drosophila_melanogaster
snoRNA name snoRNA:MeU6-C68
alias
chromosome ⁄ contig 2R
locus ⁄ host gene Rs1
organization Intronic
target RNA U6 snRNA
modification type C/D
modification site U6:C68
accession no NR_003785,AE013599
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved