snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster snoRNA:Psi28S-1192b
sequence
TAGTCCAATCTAATTCTGCATCATGGTTTATTTATGTAGTCTCGCTTTTGGACCAGATC
AAACTCCAAATCTCTTATTATCCTTGTGCTAGTGACCACTTAACTGTCCTATGCACACGA
GAAACGTAAAAGAACACTT
  Box motif
  Complementary to target RNA
length 138
organism Drosophila_melanogaster
snoRNA name snoRNA:Psi28S-1192b
alias
chromosome ⁄ contig X
locus ⁄ host gene RpS5a
organization Intronic
target RNA
modification type H/ACA
modification site 28S:U1192
accession no NR_003738,AE014298
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved