snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster snoRNA:Me18S-A627
sequence
TTGCCTGTAATGAGACCAAATTGGCCTGGTCGAATTCGAATGTGTCTGGGCCCAGTTAA
AAGGCAAATTACGCTAATGAAATGTTTTAACCCTGATGTG
  Box motif
  Complementary to target RNA
length 99
organism Drosophila_melanogaster
snoRNA name snoRNA:Me18S-A627
alias
chromosome ⁄ contig X
locus ⁄ host gene CG34104
organization Intronic
target RNA 18S rRNA
modification type C/D
modification site 18S:A627
accession no NR_003733,AE014298
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved