snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster snoRNA:Me28S-U1688
sequence
TCGACGATGATGATTCATGACCAGAGGTGCCACCTCCAAGGCGCTAATTGATGATGCAA
ACCGAGCTTATTTTAGTACACTCGAATTTTCAGCTGCCAGTGGAAGATTCACTGAATAT
  Box motif
  Complementary to target RNA
length 118
organism Drosophila_melanogaster
snoRNA name snoRNA:Me28S-U1688
alias
chromosome ⁄ contig X
locus ⁄ host gene Idgf4
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site 28S:U1688
accession no NR_003732,AE014298
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved