snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster snoRNA:M
sequence
AATTCAATGATTTCAACTTCACTGCTGACCAGCCACGCCTCAACGCCTCGGAGTGTTTG
CCCCCAGTCTCTGATAGATACACCATATTCTAATACACAC
  Box motif
  Complementary to target RNA
length 99
organism Drosophila_melanogaster
snoRNA name snoRNA:M
alias
chromosome ⁄ contig X
locus ⁄ host gene sta
organization Intronic
target RNA
modification type unknown
modification site
accession no NR_002093,AE014298
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved