snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster snoRNA:Me28S-A30
sequence
ACGTGGGTGATGAACTTCAGGGGGTAGTACTGTACTTACAGGTGTTATTGGGACTTACC
TGGTAATCGAAGGCATTTCCAGACGGGAAACTGTCTGAGAAA
  Box motif
  Complementary to target RNA
length 101
organism Drosophila_melanogaster
snoRNA name snoRNA:Me28S-A30
alias
chromosome ⁄ contig 3L
locus ⁄ host gene Eip75B
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site 28S:A30
accession no NR_003872,AE014296
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved