snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster snoRNA:MeU5-U42
sequence
GATTCGGACAAGCGAGTGGGGCAAAAGCCACCGCCGGCGCAGTTAGTCGCGTGACGAGC
AGTCGCTGGCTTCACTTCGCTGTCCCAAAATGACTACAACCTCAACTGAGTG
  Box motif
  Complementary to target RNA
length 111
organism Drosophila_melanogaster
snoRNA name snoRNA:MeU5-U42
alias
chromosome ⁄ contig 3L
locus ⁄ host gene CG12316
organization Intronic
target RNA U5 snRNA
modification type C/D
modification site U5:U42
accession no NR_002487,AE014296
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved