snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster snoRNA:Me28S-A774b
sequence
CTCTTGTTGATGAAATTAATTGGTCCGTGTTTATGAATTTCCATTGATTATAAATTCTC
CAATTACTGACCAA
  Box motif
  Complementary to target RNA
length 73
organism Drosophila_melanogaster
snoRNA name snoRNA:Me28S-A774b
alias
chromosome ⁄ contig 3L
locus ⁄ host gene RpS12
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site 28S:A774
accession no NR_003867,AE014296
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved