snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster snoRNA:Psi18S-920
sequence
TGGCAATCAGAAACCAGCTTTTTAGACCTTTTCCATGTCCATATCAGTTTGGAAATGAT
TGCAAAAGAAAAACGTGGTTTTATGTGCCAAATAAGCAACTAATATGTGGGCTGCCTTCA
TTTGCGCATTAGTCCGACAGTC
  Box motif
  Complementary to target RNA
length 141
organism Drosophila_melanogaster
snoRNA name snoRNA:Psi18S-920
alias
chromosome ⁄ contig 3L
locus ⁄ host gene RpL10Ab
organization Intronic
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U920
accession no NR_003866,AE014296
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved