snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster snoRNA:MeU2-A31
sequence
ATTTATATGATTATATTCCTGTTCTACCATATTACATTTTGTCAGAAATTTAATAGTTT
ACCAAAGCCTCGATTCTCATGCCACAAACAGAGAGATTCTCAAACCCAATGAAAAT
  Box motif
  Complementary to target RNA
length 115
organism Drosophila_melanogaster
snoRNA name snoRNA:MeU2-A31
alias
chromosome ⁄ contig 3L
locus ⁄ host gene dpr10
organization Intronic
target RNA U2 snRNA
modification type C/D
modification site U2:A30
accession no NR_003864,AE014296
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved