snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster snoRNA:28S-G3253
sequence
CCTGACCTGATGAACTGTATTAAAAAATATATTCTGACACTTCTTGTCTGATAAAATAC
GTTGACGTTAACAAATACACACTGAAGAG
  Box motif
  Complementary to target RNA
length 88
organism Drosophila_melanogaster
snoRNA name snoRNA:28S-G3253
alias
chromosome ⁄ contig 3L
locus ⁄ host gene RpS9
organization Intronic
target RNA
modification type C/D
modification site 28S:G3253
accession no NR_003863,AE014296
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved