snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster snoRNA:U49:66Db
sequence
CTGCACATGATGATAATTGAAAGTTCTTGATAGGAATTGCCGGCTGACACATATATGAA
GCTAATTCTAGTTTATCTGATTACA
  Box motif
  Complementary to target RNA
length 84
organism Drosophila_melanogaster
snoRNA name snoRNA:U49:66Db
alias
chromosome ⁄ contig 3L
locus ⁄ host gene RpL14
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site 28S:C3341
accession no NR_001955,AE014296
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved