snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster snoRNA:684
sequence
CTAAAATGCGGCACGTGCAGACACCAAGTTCCGGCTGGCTGTTGTCCGAAGATTGCAAG
ATTATGAGATCTGAGAACG
  Box motif
  Complementary to target RNA
length 78
organism Drosophila_melanogaster
snoRNA name snoRNA:684
alias
chromosome ⁄ contig 3L
locus ⁄ host gene CG10576
organization Intronic
target RNA
modification type unknown
modification site
accession no NR_002476,AE014296
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved