snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster snoRNA:Or-CD11a
sequence
AATTCTGTGATGAATGATTGAGCAGAAGAGTTCTTGAAGACTATATTCATCACCCAAGA
CTGAATAT
  Box motif
  Complementary to target RNA
length 67
organism Drosophila_melanogaster
snoRNA name snoRNA:Or-CD11a
alias
chromosome ⁄ contig 3L
locus ⁄ host gene RpL28
organization Intronic
target RNA
modification type unknown
modification site
accession no NR_003856,AE014296
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved