snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster snoRNA:Psi28S-3308
sequence
GTCGCACAAATCCCTATTGAGGCAACAGACGGCTAGTTGACCCCAGTAAGACCTTTGAA
CGCGTCTAAGTGCGAGAGAAACCGAAAGACTTGACGTCGCATTTGCCATAAACCAACTCA
ACGGAGTGGCGAATTGAAACTTCGAGTTACAAAG
  Box motif
  Complementary to target RNA
length 153
organism Drosophila_melanogaster
snoRNA name snoRNA:Psi28S-3308
alias
chromosome ⁄ contig 3L
locus ⁄ host gene CG13900
organization Intronic
target RNA 28S rRNA
modification type H/ACA
modification site 28S:U3308
accession no NR_003847,AE014296
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved